Information

11.7: Receptor-mediated Endocytosis - Biology

11.7: Receptor-mediated Endocytosis - Biology



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Just as there is vesicular traffic towards the plasma membrane, either for secretion or for incorporation of membrane lipids or proteins, there can also be vesicular traffic from the plasma membrane. Sometimes endocytosis is initiated internally, perhaps to remove a particular protein from the cell surface (for an example, see trailing edge dynamics in cell motility in the next chapter), but often, the endocytosis is the result of a ligand binding to an extracellular receptor molecule, leading to its activation and subsequent nucleation of a clathrin assembly and vesicle formation.

There are many types of ligands: a nutrient molecule (usually on a carrier protein, as in the examples below) or even an attacking virus which has co-opted the endocytic mechanism to facilitate entry into the cell. The example depicted here is a classic example: endocytosis of cholesterol (via low-density lipoprotein). This illustrates one potential pathway that the receptors and their cargo may take. In the case of cholesterol, the carrier protein is broken down fully, although in the case of transferrin, a serum protein that carries iron in the blood, the carrier protein is just recycled after releasing its transferrin cargo. It is packaged into an exocytic vesicle headed back to the cell surface.

Serum cholesterol is usually esterified and bound by LDL (low density lipoprotein), which then floats about in the bloodstream until it meets up with an LDL receptor on the surface of a cell. When the LDL binds to its receptor, the receptor is activated, and a clathrin-coated vesicle forms around the LDL/receptor complex. LDL receptors tend to aggregate in what are known as clathrin-coated pits — crater-like partial vesicles that already have a small number of polymerized clathrin molecules. The vesicle forms exactly as described previously for Golgi-derived clathrin vesicles: the clathrin self- assembles into a spherical vesicle, and dynamin pinches the vesicle off the cell membrane. This vesicle then fuses with an early endosome, which carries proton pumps in its membrane, causing the environment inside the vesicle to acidify (~pH 6). This acidification can cause conformational shifts in proteins that could, for example, lead to a receptor releasing its ligand, as is the case here with LDL and LDL receptor. The early endosome also functions as a sorting station: the receptor is re-vesicularized and transported back to the plasma membrane. Meanwhile, the LDL is packaged into a different vesicle and heads off for further processing.

The endosomal proton pumps are ATP-driven, Mg2+-dependent V-type pump (as opposed to the F-type pump in the mitochondrial inner membrane). Structurally, the two are similar though, and ATP hydrolysis drives the rotary unit, which then powers the movement of protons across the membrane from cytoplasm into endosome.

The endosomal vesicle with the LDL in it next fuses with another acidic, membrane-bound compartment. The lysosome, at pH ~5.0, is even more acidic than the endosome, and it also contains a large complement of acid hydrolases — hydrolytic enzymes ranging across substrates (including proteases, lipases, glycosidases, nucleases) that operate optimally in acidic conditions, and minimally in the neutral or slightly basic conditions in the cytoplasm. In part, this is a safety mechanism — leakage of digestive enzymes from the lysosome will not result in wholesale digestion of the cell because the enzymes have little or no activity in the cytoplasm. The lysosomal membrane, in addition to having proton pumps to acidify the internal environment, also incorporates many transporter proteins to aid in moving the digestion products of the acid hydrolases out of the lysosome so that the cell can make use of the amino acids, sugars, nucleotides, and lipids that result. Back to our example, that means that the cholesterol esters are broken apart into individual cholesterol molecules, and the lipoprotein is broken down into lipids and amino acids. Interestingly, these transporter proteins are not digested by the lysosomal proteases because they are very heavily glycosylated, which shields potential proteolytic sites from the proteases.

Lysosomal enzymes are specifically tagged by a mannose-6-phosphate that is added in the cis Golgi. This is a two-step process in which N-acetylglucosamine phosphotransferase adds a phospho-GlcNAc to a mannose residue, connecting via the phosphate group, then a phosphodiesterase removes the GlcNAc, leaving the mannose-6-P. This specifically targets lysosomal enzymes because they all have specific protein recognition sequences that the phosphotransferase binds to before transferring the P-GlcNAc. Although the lysosomal enzymes are tagged in the cis Golgi, they do not sort until the trans Golgi, when mannose-6-P receptors bind to the lysosomal enzymes and form lysosomal vesicles that will bud off and travel to late endosomes and lysosomes to deliver their acid hydrolase payload. Again, the pH change is important: in the somewhat acidic (pH 6.5) environment of the trans Golgi, the receptor binds the mannose-6-P-tagged enzymes, but in the more acidic lysosome, the acid hydrolases are released to do their work.

When one or more acid hydrolases do not function properly or do not make it into the lysosome due to improper sorting, the result is incomplete digestion of the lysosomal contents. This in turn leads to the formation of large inclusions of partially digested material inside the lysosomes. This accumulation of material can be cytotoxic, and genetic disorders that affect the expression or sorting of lysosomal hydrolases are collectively referred to as lysosomal storage diseases. These fall into several categories depending on the types of molecules accumulated.

A common and easily treatable disease of glycosaminoglycan accumulation is Hurler’s disease, which can be effectively treated and non-neurological effects even reversed by enzyme replacement therapy. Hurler’s others in its class affect a wide variety of tissues because glycosaminoglycans are ubiquitous. On the other hand, because the brain is enriched in gangliosides, lysosomal storage diseases like Gaucher’s disease show defects primarily in the CNS. Many lysosomal storage diseases have similar presentation: developmental abnormalities, especially stunted bone growth, lack of fine facial features, and neuromuscular weakness.

Since it depends greatly on the contents of the endosome(s) that fused with it, the size and contents of lysosomes can vary greatly. In fact, the lysosome may also degrade internal cellular components through the process of autophagy. Usually, this is initiated under starvation conditions which lead to inhibition of mTor, and subsequent expression of autophagic genes. These then interact with mitochondria and other cellular components, and promote the formation of a double-membraned autophagosome around them. The origin of the membranes is unclear, although the ER is suspected. Finally, the autophagosome fuses with a lysosome, and the acid hydrolases break down the cell parts for energy. A variation on this called microautophagy can also occur, in which the lysosome itself invaginates a bit of cytoplasmic material and internalizes an intralysosomal vesicle that is then broken down.

The most severe, I-cell disease (mucolipidosis type II) occurs when nearly all lysosomal enzymes are missing in the fibroblasts of the affected individual. There is severe developmental delay and early growth failure, neuromuscular problems, and malformations in early skeletal development. The severity of this disorder is due to the almost complete lack of lysosomal enzymes, which is caused by a deficiency of GlcNAc phosphotransferase. Without it, no enzymes are tagged for sorting to the lysosome.

Other relatively common disorders include Tay-Sachs and Niemann-Pick diseases. Tay-Sachs is caused by an accumulation of gangliosides in the brain and is usually fatal by 5 years of age. Niemann-Pick, on the other hand, may manifest as Type A with an even shorter life expectancy, or as Type B, in which symptoms are relatively minor. The major difference is that Type A patients have very little (<5%) of their sphingomyelinase activity, while Type B patients have only slightly less than normal (~90%) activity.

Finally, it should be noted that the large vacuoles of plant cells are in fact specialized lysosomes. Recall that vacuoles help to maintain the turgor, or outward water pressure on the cell walls that lead to a rigid plant part rather than a limp, wilted one. One of the ways in which this occurs is that the acid hydrolases inside the vacuole alter the osmotic pressure inside the vacuole to regulate the movement of water either in or out.

Another example of receptor-mediated endocytosis is the import of iron into a mammalian cell. As with serum cholesterol, iron is not generally imported into the cell by itself. Instead, it is bound to apotransferrin, a serum protein that binds two Fe3+ ions. Once it has bound the iron ions, the apotransferrin is now referred to as transferrin, and it can be recognized and bound by transferrin receptors (TfR) located on the extracellular surface of cell membranes. This initiates receptor-mediated endocytosis just as described above. However, in this case, the lysosome is not involved. As the transferrin and transferrin receptor reach the early endosome, they do not dissociate, but rather the Fe2+ releases from the transferrin, and then exits the endosome via DMT1, a divalent metal transport protein to be used in heme groups or other complexes. This leaves the apotransferrin-TfR complex, which is recycled back to the cell membrane via vesicle. Once the vesicle fuses with the extracellular space, the acidity of the endosome is dissipated and the apotransferrin no longer binds to TfR. Apotransferrin can thus go back to its duty of finding iron ions and bringing them back to the cell.


Frontiers in Immunology

The editor and reviewers' affiliations are the latest provided on their Loop research profiles and may not reflect their situation at the time of review.


  • Download Article
    • Download PDF
    • ReadCube
    • EPUB
    • XML (NLM)
    • Supplementary
      Material
    • EndNote
    • Reference Manager
    • Simple TEXT file
    • BibTex


    SHARE ON

    Introduction

    Myosin VI (Myo6) is a member of the myosin family of actin filament-based molecular motors that has been implicated in a wide range of functions including clathrin-mediated endocytosis, vesicle trafficking, cell polarity determination, and cell migration (Buss et al. 2004). Myo6 is unique among myosins in that it moves toward the pointed (minus) end of the actin filament, in the direction opposite to that of all other myosins characterized thus far (Wells et al. 1999). As actin filaments in cells are predominantly oriented with their pointed ends toward the cell interior, it has been suggested that Myo6 may use the force generated from its movement on actin filaments to pull or transport bound cargo such as nascent endocytic vesicles at the plasma membrane, uncoated apical endocytic vesicles, and membrane-bound receptors into the cell (Buss et al. 2004 Hasson 2003). In the kidney, Myo6 is highly expressed in the brush border (BB) of proximal tubule (PT) epithelial cells, where it is in part localized to the intermicrovillar (interMV) domain, the site of megalin-dependent, clathrin-mediated endocytosis of plasma proteins filtered through the glomerulus (Biemesderfer et al. 2002). This localization of Myo6 is established during PT differentiation when the cells become endocytosis-competent (Biemesderfer et al. 2002). Some Myo6 is also present within MV (Biemesderfer et al. 2002) and immunoelectron microscopy studies by Yang et al. indicate that as much as 50% of Myo6 is localized to MV in rat PT cells (Yang et al. 2005). Interestingly, these workers observed that there is a redistribution of MV-associated Myo6 to the interMV domain in rats exposed to acute high blood pressure. Thus differences in methods used for tissue preparation (e.g. perfusion-fixation pressure) may account for differences in the relative levels of MV versus interMV localization of Myo6 that has been reported.

    The PT-specific, multi-ligand endocytic receptors megalin and its binding partner cubulin, a peripheral membrane protein, mediate the reabsorption of a large number of glomerular-filtered proteins including albumin, the most abundant protein in plasma (Birn and Christensen 2006 Christensen and Gburek 2004). Because Myo6 directly binds to the clathrin-associated adaptor proteins Dab2 and GIPC ( G AIP i nteracting p rotein, C terminus)/synectin (Buss et al. 2004), which also bind megalin (Lou et al. 2002 Oleinikov et al. 2000), Myo6 may be important for protein endocytosis by PT cells. The importance of functional PT endocytosis is underscored by the correlation between the degree of proteinuria and the rate of progression of various renal diseases and in vitro findings that high protein concentrations induce the production of inflammatory and fibrogenic mediators by tubular cells (Birn and Christensen 2006). In particular, while the glomerular filtration barrier prevents the passage of most of the serum albumin into the tubular lumen, an appreciable amount of albumin is filtered by the glomerulus and subsequently reabsorbed by the PT (Birn and Christensen 2006 Gekle 2005), and the amount of albumin excreted in urine, which reflects the integrity of these two processes, is an important indicator of renal disease.

    In vitro studies using dominant negative Myo6 expression in cell lines have shown that Myo6 is essential for clathrin-mediated endocytosis and trafficking of uncoated endocytic vesicles (Aschenbrenner et al. 2003 Buss et al. 2001). Moreover, in Myo6-deficient neurons cultured from the Myo6 functional null Snell’s waltzer (sv/sv) mouse, there is selective inhibition of clathrin-mediated endocytosis, as glutamate but not transferrin receptor internalization is inhibited (Osterweil et al. 2005). These mice also exhibit reduced and delayed apical endocytosis of CFTR in jejunal enterocytes (Ameen and Apodaca 2007). Sv/sv mice are deaf, and their only overt abnormal phenotypes are circling/hyperactive behavior resulting from degeneration of the inner ear neurosensory epithelium (Avraham et al. 1995 Deol and Green 1966) and smaller body size. In this study, we investigated the physiologic and histologic consequences of loss of Myo6 function in the kidney. Physiological measurements and renal clearance studies showed elevated blood pressure in sv/sv mice compared to control animals while maintaining normal glomerular filtration rate (GFR), urine volume, and urine concentrating ability. Urinary albumin levels were elevated in sv/sv mice, and in vivo uptake of HRP was impaired in sv/sv PTs, indicating a role of Myo6 in PT protein endocytosis. In addition, sv/sv kidneys showed decreased association of adaptin β and Dab2 with the BB membrane and reduced apical vacuole number in PT cells. Histologically, sv/sv kidneys exhibited PT dilation and fibrosis with signs of epithelial-mesenchymal transdifferentiation (EMT) of the tubular cells. This study shows the presence of deficits in protein reabsorption and pathology in the sv/sv kidney, with the interesting finding that overall renal function is largely maintained.


    Abstract

    Apical transport is key in renal function, and the activity of efflux transporters and receptor-mediated endocytosis is pivotal in this process. The conditionally immortalized proximal tubule epithelial cell line (ciPTEC) endogenously expresses these systems. Here, we used ciPTEC to investigate the activity of three major efflux transporters, viz., breast cancer resistance protein (BCRP), multidrug resistance protein 4 (MRP4), and P-glycoprotein (P-gp), as well as protein uptake through receptor-mediated endocytosis, using a fluorescence-based setup for transport assays. To this end, cells were exposed to Hoechst33342, chloromethylfluorescein-diacetate (CMFDA), and calcein-AM in the presence or absence of model inhibitors for BCRP (KO143), P-gp (PSC833), or MRPs (MK571). Overexpression cell lines MDCKII-BCRP and MDCKII-P-gp were used as positive controls, and membrane vesicles overexpressing one transporter were used to determine substrate and inhibitor specificities. Receptor-mediated endocytosis was investigated by determining the intracellular accumulation of fluorescently labeled receptor-associated protein (RAP-GST). In ciPTEC, BCRP and P-gp showed similar expressions and activities, whereas MRP4 was more abundantly expressed. Hoechst33342, GS-MF, and calcein are retained in the presence of KO143, MK571, and PSC833, showing clearly redundancy between the transporters. Noteworthy is the fact that both KO143 and MK571 can block BCRP, P-gp, and MRPs, whereas PSC833 appears to be a potent inhibitor for BCRP and P-gp but not the MRPs. Furthermore, ciPTEC accumulates RAP-GST in intracellular vesicles in a dose- and time-dependent manner, which was reduced in megalin-deficient cells. In conclusion, fluorescent-probe-based assays are fast and reproducible in determining apical transport mechanisms, in vitro. We demonstrate that typical substrates and inhibitors are not specific for the designated transporters, reflecting the complex interactions that can take place in vivo. The set of tools we describe are also compatible with innovative kidney culture models and allows studying transport mechanisms that are central to drug absorption, disposition, and detoxification.


    Abstract

    The uptake of nanoparticles (NPs) by a cellular membrane is known to be NP size dependent, but the pathway and kinetics for the endocytosis of multiple NPs still remain ambiguous. With the aid of computer simulation techniques, we show that the internalization of multiple NPs is in fact a cooperative process. The cooperative effect, which in this work is interpreted as a result of membrane curvature mediated NP interaction, is found to depend on NP size, membrane tension, and NP concentration on the membranes. While small NPs generally cluster into a close packed aggregate on the membrane and internalize, as a whole, NPs with intermediate size tend to aggregate into a linear pearl-chain-like arrangement, and large NPs are apt to separate from each other and internalize independently. The cooperative wrapping process is also affected by the size difference between neighboring NPs. Depending on the size difference of neighboring NPs and inter-NP distance, four different internalization pathways, namely, synchronous internalization, asynchronous internalization, pinocytosis-like internalization, and independent internalization, are observed.


    DISCUSSION

    Our data suggest the determination of a shared domain in β-adaptins and the regulatory subunit H of the vacuolar ATPase with significant structural and functional similarity. Furthermore, in β-adaptins this domain exhibits specificity for di-leucine–based sorting motifs and is involved in endocytic trafficking. This finding supports previous results of limited tryptic proteolysis of AP-1, which suggested that the interaction site of the LL motif in CD3γ resides in the N-terminal ∼65-kDa trunk portion of β1 (Rapoport et al., 1998).

    In this report we show that the di-leucine–based internalization motif of Nef binds to the ARM repeat structure of V1H (133–483), which exhibits sequence homology to β-adaptins (Figures 2-4). Expression of the homologous fragments from V1H, β1, and β2 in cells blocks the internalization of transmembrane proteins, which depend on di-leucine–based sorting motifs (Figures 5 and 6). Both β-adaptin fragments β1F and β2F from adaptor protein complexes AP-1 and AP-2 display a homogenous distribution throughout the cytoplasm and the plasma membrane of transfected cells (Figure 5). This observation suggests that the specificity of AP-complexes for different subcellular localizations results from subunits that exhibit a higher degree of heterogeneity, namely the large α- and γ-subunits (Boehm and Bonifacino, 2001), whereas the highly homologous fragments β1F and β2F identified here (92.3% sequence identity) form a structurally and functionally similar domain. Thus, expression of the various LL-binding domains should lead to their association with di-leucine motifs at virtually all subcellular locations without discriminating between distinct transport complexes. Because the LL-binding domains miss the hinge region containing the clathrin box signal as well as the successive β-appendage domain, the recruitment of transport competent complexes is inhibited upon binding to a di-leucine motif. Interestingly, this dominant negative effect is reminiscent to that of the VHS-GAT construct of the GGA1 protein used by Puertolanoet al. (2001).

    Very recently, the acidic-cluster-di-leucine motif of the cytosolic tails of sortilin and the mannose 6-phosphate receptor was found to bind the VHS domain of GGA proteins (Nielsen et al., 2001Puertollano et al., 2001 Zhu et al., 2001). The monomeric GGAs are a multidomain protein family implicated in protein trafficking between the Golgi and endosomes. Previous structural analysis shows that the small 18-kDa VHS domain of the Hrs protein consists of three HEAT or ARM repeats (Mao et al., 2000), a protein fold that has been recently found also in the structure of the regulatory subunit H of the V-ATPase (Sagermann et al., 2001). On the basis of the sequence similarity found, we conclude that also β-adaptins and β-COP are HEAT or ARM repeat–containing proteins. These observations suggest that HEAT or ARM repeats form the structural scaffold for the recognition of di-leucine–based sorting motifs. The detailed specificity for the sequence motifs recognized, however, has to be determined individually for each protein family. In accordance with our data, additional specificity for the binding to LL-motifs in β-adaptins may come from the μ-chain of the adaptor protein complexes as suggested before (Hofmann et al., 1999). Because the N-terminal trunk of β-adaptins is supposed to bind the μ-chain in the AP assembly (Hirst and Robinson, 1998Kirchhausen, 1999), the interface of these two molecules could contribute to a combinatorial surface for di-leucine–based motif recognition.

    A major difficulty in the analysis of endocytic trafficking compartments is with the low-affinity recognition of the various motifs in vitro (Marsh and McMahon, 1999 Pearse et al., 2000). For the LL-motif, this observation is additionally paired with a low signature specificity because leucines are the most abundant residues, and two successive hydrophobic residues occur often statistically. Formation of a multiple helix bundle, as is the repetitive HEAT or ARM repeat fold, is often less sensitive to N- or C-terminal truncation than a β-pleated sheet, as is, e.g., the YxxL binding domain in μ2. In μ2, the first β-sheet of the 280-residue YxxL-binding domain associates with the second last β-sheet (Owen and Evans, 1998), and truncations at both ends result in the immediate loss of binding recognition (Aguilar et al., 1997). For the N-terminal trunk portion of β-adaptins with its proposed helical structure instead, we suggest that a protein fragment that does not reflect precisely the required LL-binding domain but exhibits flexible linker segments may block its own target site. Therefore, the transfer of the mapping results from V1H based on sequence similarities to β-chains may have been key to determine a fragment in β-adaptins that binds to di-leucine–based sorting motifs.

    On a speculative level we suggest that the clathrin box signal LLNLD (Shih et al., 1995) or other LL sites in the flexible hinge region of β-adaptins compete in a dynamic exchange process with di-leucine-sorting motifs for the binding to its target site. This intramolecular interaction would be disrupted by the recognition of a bona fide LL-sorting signal, which leads to continuous exposure of the clathrin box signal and subsequently induces the assembly of AP-clathrin coats. Interestingly, in β1 and β2 adaptins 5 LL and 3 LI sites are present within the 194 residues between the LL-binding domain identified here and the β-appendage domain (Figure7B). This autoinhibition could induce a functional switch by a conformational change that indicates cargo uptake and initiates clathrin coat formation. This model would also explain why empty clathrin cages are never observed in vivo (Kirchhausen, 1999) and correlate with previous observations by electron microscopy that show various dispositions of the appendage domain relative to the trunk portion (Heuser and Keen, 1988). Interestingly, autoinhibition by an internal nuclear localization signal was discovered for Importin α and found to explain the regulatory switch between the cytoplasmic, high-affinity form, and the nuclear, low-affinity form for NLS binding of the Importin (Kobe, 1999).

    Fig. 7. Model representation of the di-leucine sorting motif in Nef and proposed domain organization of its target sites. (A) Sequence of the flexible loop (residues 152–184) of HIV-1 Nef (SF2) and model structure. Eight adjacent aspartic and glutamic acid residues form a strong negative charged cluster at the N- and C-termini of the flexible loop while the di-leucine–based motif ExxxLL is best exposed at its center. The degree of similarity conservation based on 186 analyzed sequences (Geyer and Peterlin, 2001) is printed aside the sequence. The formation of the negative charged cluster is indicated in the electrostatic surface display (right). The figure was generated with GRASP (Nicholls et al., 1991) using an electrostatic potential display of −16 kBT (red) to +16 kBT (blue). (B) Proposed modular organization for the di-leucine binding domain in β2 and its homologous domains in V1H and β-COP. The flexible hinge region containing the clathrin box signal and the β-appendage domain are marked. Protein domain sequences share 20.3% identity between V1H and β2 and 19.9% identity between β2 and β-COP. The consensus site GEY in all three proteins (position 415 in V1H) is indicated.

    Under normal circumstances, CD4 molecules are internalized from the plasma membrane via a di-leucine motif in their cytoplasmic tail. How can Nef enhance CD4 endocytosis from the plasma membrane using a similar di-leucine–based motif for internalization? Most di-leucine–based sorting motifs contain an upstream acidic residue (D/ExxxLL) or additional phosphorylation sites (Wilde and Brodsky, 1996). A minimal spacing from the plasma membrane as well as these acidic residues N-terminal to the LL-motif were found to be critical for internalization (Geisler et al., 1998). Although the cytosolic part of CD4 does not contain these acidic residues but is rather positively charged (pI 11.7), unless phosphorylated on its serine residues (Pitcher et al., 1999), the 33 amino acids encompassing flexible loop of Nef contains 10 acidic residues (pI 4.0) mostly located at its two ends (Figure 7A). These residues face each other and form a highly conserved negative cluster upstream to the LL-motif (Geyer and Peterlin, 2001), which can be described as a EEx8LLx8DD internalization signal. In the membrane-bound Nef protein these acidic residues may lead to exposure of the LL-motif to the cytosol and satisfy the preference of negative charges for the recognition of the di-leucine-binding domain and therefore enhance internalization of the CD4-Nef complex compared with CD4 alone. Thus, the interaction of Nef with CD4 would transform the phosphorylation depended di-leucine signal from CD4 into a constitutively active di-leucine signal from Nef.

    The similarities found for the fragments in V1H, β-adaptins, and β-COP suggest a common modular organization of the three different proteins (Figure 7B). They could contribute to recently described shared domain organization of adaptor protein complexes and coatomer assemblies (Eugster et al., 2000 Boehm and Bonifacino, 2001). Also, our results suggest a related function for the regulatory subunit H of the vacuolar ATPase. Because interactions between the V1 and V0 sector of the V-ATPase are dynamic and regulated by extracellular conditions (Kane, 2000), V1H could act as a specialized trafficking molecule. Future studies will unravel whether the entire V-ATPase is required for the functions of V1H in intracellular sorting and how these processes are regulated. With the identification of the domain organization in the N-terminal trunk of β-adaptins, precise functional and structural studies are now possible. The dominant negative effects of the LL-binding domains should become useful for functional studies on the trafficking of proteins that contain di-leucine–based sorting motifs. Moreover, the stability of the identified domain appears promising for its subsequent crystallization and structural characterization.


    Materials and Methods

    1. Western blot with live P. larvae and E. coli

    Wintertime worker honey bee hemolymph (hl) and fat body protein extract (fb) are rich in Vg, and were used for testing Vg-binding to bacteria, adapted from the fish Vg experiment by Tong et al. [17] using an antibody that detects honey bee Vg. For cell-free hl and fb sampling, see Havukainen et al. [33]. The experiment was performed at room temperature, centrifugation steps were 3,000 g for 5 min, and wash volume was 0.5 ml of PBS, if not mentioned otherwise. P. larvae (strain 9820 purchased from Belgian Co-ordinated Collections of Micro-organisms, Gent, Belgium) grown on MYPGP agar plates for 7 days and Epicurian Gold E. coli grown in LB medium liquid culture overnight were washed and suspended in 100 μl PBS per sample. The bacteria suspensions (

    1.3 x 10 8 cells/ml) were mixed with either an equal volume of hemolymph diluted 1/10 in PBS with a protease inhibitor cocktail (Roche, Penzberg, Germany) or with fat body protein extract (5.7 mg/ml total protein in PBS with the protease inhibitors). The following negative controls were used: 1) 100 μl P.larvae and E. coli with an equal volume of PBS but no hl/fb, to detect possible unspecific antibody binding to the bacteria, 2) 100 μl fb with an equal volume of PBS, but no bacteria, to detect possible Vg aggregation, and 3) 100 μl P.larvae and E. coli treated with 100 μl 5 mg/ml bovine serum albumin (BSA control protein). As untreated controls, we kept on ice 0.1 μl of hl, 0.5 μl of fb extract, and 1 μl of BSA. The samples were incubated at 26°C for 50 min under agitation for Vg-bacteria binding to occur. The bacteria were washed six times. The final pellet was resuspended in 10 μl of 4 M urea in PBS, agitated for 15 min and centrifuged. The samples were blotted on a nitrocellulose membrane according to a standard horse-radish peroxidase conjugate protocol with the Vg antibody tested before [33,34] (dilution 1:25,000 Pacific Immunology, Ramona, CA, USA), or a commercial BSA antibody (1:2000 Life Technologies, Carlsbad, CA, USA). The bands were visualized using Immune-Star kit and ChemiDoc XRS+ imager. All blotting reagents were purchased from Bio-Rad (Hercules, CA, USA).

    2. Microscopy of P. larvae and E. coli

    Vg-binding to bacteria was further tested by fluorescence microscopy. The incubation with hl was as above, except hl and bacteria volumes were both 20 μl and the number of bacterial cells was

    3 x 10 6 . All centrifugation steps were 10,000 g, +4°C, 5 min and PBS-T wash volumes were 1 ml. After hl incubation with the bacteria, the bacteria were washed and fixed with 4% paraformaldehyde for 10 min in room temperature. The cells were washed twice and blocked with 5% milk in PBS-T for 30 min in room temperature and washed again. Vg primary antibody (same as above) was used 1:50 in PBS-T and 1% milk for overnight incubation at +4°C. The samples were washed twice and incubated with Alexa fluor 488 nm anti-rabbit antibody, 1:50, for 1 h in room temperature in dark and washed three times. DNA was stained with standard propidium iodide (PI) protocol (Invitrogen). The bacteria were mounted with glycerol and imaged with Zeiss Axio Imager M2, excitations 499 nm and 536 nm, and emissions 519 nm and 617 nm. The primary antibody was omitted in the treatment of the secondary antibody control samples.

    3. Surface plasmon resonance with LPS, PG and zymosan

    Vg was purified from honey bee hemolymph with ion-exchange chromatography as described before [20,34]. Biacore T200 instrument (GE Healthcare, Waukesha, USA) and buffers from the manufacturer were used. The analytes were bought from Sigma Aldrich: PG from S. aureus #77140, LPS from E. coli #L2630 and zymosan from S. cerevisiae #Z4250. 30 μl/ml Vg in 10 mM acetate buffer pH 4.5 was immobilized on a CM5 chip—primed and conditioned according to the manufacturer’s instructions—until the response reached 5150 RU. The chip was blocked using ethanolamine. The analytes were suspended in the running buffer (0.1 M HEPES, 1.5 M NaCl and 0.5% v/v surfactant P20) and heated at 90°C for 30 min with repeated vigorous vortexing, followed by spinning in a table centrifuge for 20 min. Zymosan was heated for an additional 30 min at 95°C before centrifugation. PG and zymosan form a fine suspension in water solutions, and they formed a pellet during the centrifugation their concentrations are given here as the weight added to the volume. The analytes were run with 120 s contact time and 600 s dissociation time with a 30 μl/min flow rate at 25°C. The analytes flowing in a separate channel on a naked chip was used as a blank, whose value was subtracted from the sample. After optimizing the binding-range, the following concentrations were measured. PG: 0, 0.25, 0.5, 2, 3, 5 mg/ml LPS: 0, 0.1, 0.2, 0.9, 1.8, 3 mg/ml, and zymosan: 0, 0.5, 1, 2, 3, 4 mg/ml. PG and LPS binding did not reach binding saturation, yet, we did not exceed 5 mg/ml or 3 mg/ml concentration, respectively, to avoid analyte aggregation (see the manufacturer’s information and references therein for work concentrations).

    4. Microscopy of queen ovaries

    Six one year old A. mellifera ligustica queens were anesthetized on ice. Their ovaries were dissected and washed in ice cold PBS. One of the paired ovaries per queen was then placed in control solution (50 μl PBS containing 2 mg/ml Texas Red labeled E. coli Bioparticles Life Technologies, Carlsbad, CA, USA) and the other ovary was placed in the same solution that contained, in addition, 0.5 mg/ml Vg purified from honey bee hemolymph [20,33]. The ovaries were incubated at 28ºC for 2 h under agitation. Next, the ovaries were washed twice in 1 ml ice cold PBS for 5 min under agitation. Samples of two queens were directly mounted using Fluoromount (Sigma) and observed by bright field and fluorescence (excitation 595 nm, emission 615 nm) microscopy (Axio Imager M2, Carl Zeiss AG, Oberkochen, Germany). One additional untreated control queen was imaged for detection of the autofluorescent pedical area of the ovary. The remaining four queens were embedded in Tissue-Tek (Sakura Finetek, Torrance, CA, USA) and stored in -80ºC. These ovaries were cut in 17 mm sections at -20ºC, and imaged immediately after mounting. The microscopy settings were kept constant during imaging.

    To test whether hemolymph proteins could trigger the uptake of immune elicitors even in the absence of Vg, we modified the experimental setup to include hemolymph proteins other than Vg, the majority of which are apolipophorin and hexamerins, both known to bind to immune elicitors [35]. The other hemolymph proteins were obtained by running ion-exchange chromatography on honey bee hemolymph and dividing the collected hemolymph fractions into Vg and non-Vg proteins (S1 Fig) [20,33]. Remaining small molecular weight hemolymph molecules, such as possible peptides and hormones, were removed during protein concentration using centrifugal filters with 50 kDa cutoff with both Vg and non-Vg fractions (Millipore, Billerica, MA, USA). Fractions containing both Vg and other hemolymph proteins were discarded. The Vg and the non-Vg proteins had a final concentration of 0.5 mg/ml in the experiment. The queens were as above. The setup was as follows (all incubations contained the E. coli Bioparticles 1.5 mg/ml): one ovary was incubated with Vg and the other ovary with control solution (see above) (N = 3) one with Vg and the other with non-Vg hemolymph proteins (N = 3), and one ovary with non-Vg hemolymph proteins and the other with control solution (N = 2). The cryo-section imaging was done as above.


    Results

    Generation of EHD1-deficient mice

    EHD1-deficient mice were generated using a recombineering strategy as described in Methods (Figure 1A). PCR analysis of tail DNA confirmed the Ehd1 gene was correctly targeted in heterozygous deleted (Ehd1 +/- ), homozygous deleted (Ehd1 -/- ), heterozygous floxed (Ehd1 fl-Neo/+ ), and homozygous floxed (Ehd1 fl-Neo/fl-Neo ) mice (Figure 1B). RT-PCR also confirmed the absence of Ehd1 mRNA in the testis of Ehd1 -/- male mice (Figure 1C).

    Generation of Ehd1 -/- mice using Cre/ loxP -mediated genetic recombineering. (A) A partial restriction map of the Ehd1 locus, the targeting vector and the mutated Ehd1 loci. The first exon was deleted by Cre/loxP-mediated recombination. Black rectangles represent exons, grey and white triangles represent loxP and FRT sequences, respectively. H, HindIII RI, EcoRI. (B) DNA was prepared from mouse tails for genotyping by PCR to amplify the WT Ehd1 allele, the deleted allele and/or the floxed allele. The lane labeled "no template" indicates a negative control in the absence of DNA. (C) RT-PCR analysis was carried out using cDNA generated from mouse testes and primers specific for Ehd1 and Ehd4. The primers are described in Methods.

    Previously, we showed that EHD proteins were expressed in several mouse organs in both male and female mice [7]. Western blots performed on lysates of mouse organs obtained from WT, Ehd1 +/- and Ehd1 -/- mice confirmed that disruption of Ehd1 led to a loss of EHD1 protein expression in Ehd1 -/- male (Figure 2) as well as female mice (data not shown). Intermediate levels of EHD1 were seen in the lung, kidney, heart, spleen, and testis of Ehd1 +/- mice when compared to WT and Ehd1 -/- mice (Figure 2). These results demonstrated that the targeting strategy led to complete loss of EHD1 expression in Ehd1 -/- mouse tissues.

    EHD protein expression in adult WT, Ehd1 +/- and Ehd1 -/- male mice. Aliquots of 100 μg tissue lysates derived from seven month old male mice were separated using 7.5% SDS-PAGE and Western blots were performed using antisera raised against EHD proteins as described in Methods. The * denotes bands that bled through from the previous blot following stripping. Differential mobility of Hsc70 may represent tissue specific isoforms. Relative molecular weight (MW) markers are indicated in kiloDaltons (kD). Hsc70 served as a loading control.

    Deletion of Ehd1in different mouse strains results in partial lethality

    Crosses of Ehd1 +/- mice on a 129B6 mixed background did not produce the expected Mendelian ratio of Ehd1 -/- mice (8% instead of the expected 25% were Ehd1 -/- at post-natal days 10-12) (Table 1). These results indicated that loss of EHD1 was partially lethal. Similar results were seen after seven backcrosses (N7) to the FVB/NJ strain (11% instead of the expected 25% were Ehd1 -/- n = 106 mice). The 129B6 mixed strain was used in further analyses unless specified.

    The progeny from crosses of Ehd1 +/- mice were 49% female and 51% male with twice as many Ehd1 +/- as compared to WT mice, indicating normal gender ratios and a lack of lethality when one copy of Ehd1 was present. A separate study was conducted where the genotype of pups that died from unknown causes between post-natal days 0 and 2 were examined. Interestingly, 24 of 48 pups (50%) were Ehd1 -/- mice, indicating a disproportionately higher frequency (expected

    25%) of death among Ehd1 -/- mice at or near birth.

    Ehd1 -/- mice are smaller than WT mice and display developmental defects

    Ehd1 -/- mice that survived early neonatal lethality were smaller than WT and Ehd1 +/- littermates from birth (Figure 3A) to adulthood (Figure 3B). Both male and female mice showed lower weights as compared to controls (Figure 3C-D). In several cases, Ehd1 -/- females displayed malocclusion (4/18, 22%) which required bi-weekly incisor trimming into adulthood to prevent death. A few animals were euthanized due to abnormally small size and malnutrition at age 3-4 weeks independent of incisor problems and several others perished around this time due to unknown causes. A substantial proportion of the surviving Ehd1 -/- animals displayed gross ocular defects (

    55% of eyes n = 39 animals) including anophthalmia (rare), microphthalmia (severe cases exhibited closed eyelids), and congenital central cataracts. The nature of eye developmental defects in Ehd1 -/- mice is being pursued separately.

    Ehd1 -/- mice are smaller than littermate controls and adult Ehd1 -/- males exhibit small testis. (A) Newborn pups and (B) seven month old male mice were photographed to show the size of the Ehd1 -/- mice as compared to littermate controls. (C) Quantitative growth curves of male and (D) female littermate control mice (n value shown for each). (E) Seminal vesicles and testis were dissected from mice pictured in (B). Error bars represent standard deviation from the mean. ** indicates statistically significant using a two-sample t-test with a two-tailed analysis (p < 0.05).

    Ehd1 -/- male mice are infertile

    Despite our repeated attempts to mate Ehd1 -/- mice, no progeny were generated indicating the lack of fertility of either one or both genders. Breeding Ehd1 +/- males with Ehd1 -/- females gave rise to healthy pups (Table 1) only 29% (instead of 50% expected) of the mice that survived to weaning age were Ehd1 -/- . For unknown reasons, the percentage of Ehd1 -/- mice surviving to weaning age compared to Mendelian predictions were higher when raised by an Ehd1 -/- dam versus an Ehd1 +/- dam. These results further documented that Ehd1 -/- females were fertile and the partial lethality in Ehd1-null mice (currently under investigation).

    To test if Ehd1 -/- males were fertile, 8-week old males were housed with two virgin adult females each. Despite normal mating behavior, as determined by their ability to mount females and give rise to a copulatory plug, no Ehd1 -/- male mice were capable of siring offspring, indicating that Ehd1 -/- males were infertile (Table 1). Females used in these experiments were proven competent at being impregnated by other fertile males after initial breeding with Ehd1 -/- males. The ability of eight Ehd1 fl-Neo/fl-Neo breeding pairs to successfully produce progeny provided evidence that the presence of loxP sites in the targeted Ehd1 gene did not cause defects in fertility or overall survival by influencing an untargeted gene.

    Previously, a C-terminal deletion of EHD1 in mice was shown to have no effects in viability, growth or fertility in 129/SvEv or Swiss Webster strains [27]. To determine whether fertility defects in the Ehd1 -/- male mice were influenced by genetic background, we crossed Ehd1 +/- mice two times into the FVB/NJ strain (N2) and then generated Ehd1 -/- mice. The resulting Ehd1 -/- male mice were infertile while Ehd1 -/- female mice were fertile (n = 8). Further backcrossing revealed that Ehd1 -/- male FVB/NJ strain (N7) mice were also infertile (n = 4), indicating that loss of EHD1 leads to complete infertility in male mice irrespective of strain.

    Adult Ehd1 -/- male mice exhibit small testes

    The raw weights of testes, spleen and kidneys of Ehd1 -/- male mice at post-natal day 10 and 30 were not statistically different from WT mice (Table 2). However, from day 42, the testes in Ehd1 -/- mice were smaller than that of WT mice indicating the first delay in testes development as determined by weight (Table 2, Figure 3E). Interestingly, the androgen-dependent seminal vesicles were comparable in size between WT, Ehd1 +/- and Ehd1 -/- mice (Table 2, Figure 3E) suggesting that hormone levels were unaffected. Serum testosterone levels of mice were variable however, levels in Ehd1 -/- mice were within a range comparable to those of WT and Ehd1 +/- adult mice (824.5 ± 1364.0 ng/dL for WT [n = 3], 646.1 ± 859.4 ng/dL for Ehd1 +/- [n = 2] and 445.8 ± 511.4 for Ehd1 -/- [n = 11], ages 9-69 weeks, p > 0.05). The small testis size phenotype was similar in N2 and N7 FVB/NJ mice (data not shown).

    EHD1 expression in post-natal mouse testis development

    To assess the Ehd1 mRNA expression, in situ hybridizations were carried out in developing mouse testes. Ehd1 mRNA was expressed in most cells of the seminiferous epithelia (Figure 4) including Sertoli cells (Figure 4, E' inset).

    Ehd1 mRNA expression in post-natal mouse testis development. In situ hybridizations were performed as described in Methods on WT (+/+) and Ehd1 -/- (-/-) testis sections prepared from post-natal day 10, 30, 36, 42 (P10-P42) and 10 month old (10 m) mice. Ehd1 mRNA expression can be seen as red in dark-field images overlaid on bright-field images. Panels A'-I' are higher magnifications of panels A-I, respectively. The inset within E' is an enlarged micrograph of the box in E' arrows denote Sertoli cell nuclei. The scale bar in panel I is 100 μm for B-J, 50 μm for A, C'-I' and 25 μm for A'.

    To assess the EHD protein expression at early stages of testis development, a Western blot was performed (Figure 5A, upper panel). EHD1, EHD2 and EHD4 were expressed in WT testis at days 10-42 while EHD3 levels were relatively low. Interestingly, Ehd1 -/- testes displayed an increase in EHD2, EHD3 and EHD4 expression at day 30, 36 and 42. EHD1, EHD2 and EHD4 were also expressed in an immortalized mouse Sertoli cell line (TM4) as analyzed by Western blot (Figure 5A, lower panel).

    EHD protein expression and EHD1 localization during mouse testis development. (A, upper panel) Aliquots of 50 μg testis lysates from post-natal day 10-42 mice were separated using 8% SDS-PAGE and a Western blot was performed using affinity purified antibodies raised against EHD1 (described in Methods), followed by serial reprobing with antisera raised against EHD proteins as described previously [7]. β-Actin served as a loading control. The * denotes bands that bled through from the previous blot. (A, lower panel) Aliquots of 20 μg immortalized mouse TM4 Sertoli cell and mouse embryonic fibroblast (MEF, Ehd1 fl-Neo/fl-Neo ) lysates were treated similarly except the membrane was probed with antisera that recognize EHD1 and EHD4 followed by EHD2. (B, C) Immunohistochemistry was carried out to determine EHD1 localization in day 10 and day 30 formalin-fixed testis sections from WT and Ehd1 -/- mice. EHD1 expression can be seen as brown staining nuclei are counter-stained with hematoxylin (blue). Panels A and B contained affinity purified anti-EHD1 primary antibodies while panels C and D lacked primary antibodies (control). Insets in panel A are enlarged micrographs of the highlighted cells. Note: similar seminiferous tubules from adjacent sections can be seen in A and C as well as B and D denoted by asterisks (**). Sc - Sertoli cell, Sg - spermatogonia. Scale bar = 100 μm.

    To determine EHD1 localization within the testis, immunohistochemistry was performed and revealed EHD1 expression in most cells of the seminiferous epithelium. At post-natal day 10, EHD1 was expressed in the cytoplasm of both spermatogonia (filled arrowheads) and Sertoli cells (open arrow-heads) at the basement membrane with higher signals near the lateral and apical surfaces of these cells (Figure 5B, panel A). EHD1 expression was also seen around the nucleus of spermatogonia (arrow) towards the lumen of seminiferous tubules (Figure 5B, panel A). As expected, EHD1 expression was absent in Ehd1 -/- testis (Figure 5B-C, panel B). At day 30, EHD1 was localized in the cytoplasm of Sertoli cells and spermatogonia near the base of seminiferous tubules. In addition, EHD1 was expressed in pachytene spermatocytes, and round and elongated spermatids (Figure 5C, panel A). Similar patterns were observed in adult WT testis (not shown).

    Ehd1 -/- mice show a range of abnormalities in spermatogenesis

    During spermatogenesis, spermatogonia undergo mitotic divisions and differentiate into spermatocytes. Spermatocytes undergo two meiotic divisions, differentiate to round spermatids that later form elongated spermatids and are released from Sertoli cells during spermiation. Progression of spermatogenesis is described using histology of seminiferous tubule cross-sections in stages (I-XII) that define the morphological development of germ cells as a group [28, 29]. The morphology of an individual spermatid in spermiogenesis is described as a step that is most easily followed by Periodic Acid-Schiff (PAS)-stained acrosome formation and shape, or less easily by assessing chromatin condensation and spermatid head shape [28]. In order to discern initial lesions in spermatogenesis, we carried out histological analyses of testes in 10, 30, and 42 day old mice. At each age, the average width of seminiferous tubules was comparable between WT and Ehd1 -/- mice indicating that lumen formation by the seminiferous epithelia was unaffected in the absence of EHD1 (Table 2).

    At post-natal day 10, the WT seminiferous tubules predominantly contained Sertoli cells and some pachytene spermatocytes, the most advanced germ cell type seen at this age (Figure 6A). Spermatogonia were present near the basement membrane and few apoptotic features were seen (Figure 6B) [30]. Ehd1 -/- seminiferous tubules were similar in appearance, also displaying some apoptotic features in the lumen and near the basement membrane (Figure 6C-D). There appeared to be a delay in the normal maturation of spermatogonia and pachytene spermatocytes in Ehd1 -/- as compared to WT mice as analyzed by chromatin condensation and cell size. In addition, some Ehd1 -/- seminiferous tubules contained a greater number of apoptotic-like dense bodies than WT. However, no major lesions were detected in the seminiferous tubules of Ehd1 -/- mice at day 10.

    Post-natal day 10 tubule cross-sections of Ehd1 -/- male mouse testes show no major lesions. Day 10 testes were Bouin's-fixed, PAS-stained and hematoxylin-counter-stained to visualize the glycoproteins/acrosomes (pink) and nuclei (blue) and analyzed by light microscopy using a 40× objective lens. Stages are labeled with Roman numerals. (A, B) The seminiferous tubules of WT (+/+) mice exhibit Sertoli cell nuclei (Sc) near the basement membrane or toward the lumen, large spermatogonia (Sg) near the basement membrane, pachytene spermatocytes (P) and occasional apoptotic-like (Ap) nuclei near the lumen. (C, D) The seminiferous tubules of Ehd1 -/- (-/-) mice are shown for comparison. Scale bar in A = 50 μm for A-D.

    At day 30, normal spermatogenesis was apparent in WT mice with well-organized germ cells typical of the first wave of spermatogenesis. In general, Sertoli cells were near the basement membrane while elongated spermatids lined the lumen (Figure 7A, stage I-II) and normal meiosis was observed in spermatocytes (Figure 7A, stage XII). Round spermatids displayed a round/ovoid appearance until stage IX when the spermatid head formed a dorsal and ventral surface with the acrosome primarily on the dorsal surface of step 9 spermatids (Figure 7B). In contrast, Ehd1 -/- seminiferous tubules showed abnormal cells in meiosis (Figure 7C, stage XII) and elongated spermatids that displayed abnormal orientation, shape and chromatin condensation (Figure 7C, stage X). Some Ehd1 -/- seminiferous tubules displayed a Sertoli cell only phenotype not seen in the WT (Figure 7D) indicating a complete lack of germ cells. Interestingly, a delay in the maturation of elongated spermatids was observed with a mixture of spermatids (step 9, 10, and 11) present in a seminiferous tubule cross-section (Figure 7E). In WT mice, the PAS-positive acrosomal cap of round spermatids covered more than one third of the nucleus at stage VII with a central acrosomal granule (Figure 7F). However, in Ehd1 -/- mice, the acrosomal caps appeared abnormal with asymmetric formations (Figure 7G) and punctate appearances (Figure 7H). Neither the Ehd1 -/- nor the WT epididymides contained spermatozoa at day 30, confirming that these animals were in the initial waves of spermatogenesis. Since round spermatids form prior to day 30 (days 20-25), there may be lesions that were not elucidated in the current study.

    Abnormal acrosome and spermatid development in adolescent Ehd1 -/- male mice. Day 30 testes were Bouin's-fixed, PAS-stained and hematoxylin-counter-stained to visualize the glycoproteins/acrosomes (pink) and nuclei (blue) and analyzed by light microscopy using a 40× objective lens (A-E) or 60× objective lens under oil immersion (F-H). Stages are labeled with Roman numerals. (A) WT (+/+) stage XII seminiferous tubules with step 12 elongated spermatids and spermatocytes in meiosis I and II. (B) WT stage IX seminiferous tubules with step 9 spermatids. (C) Ehd1 -/- (-/-) stage XII seminiferous tubules display abnormal meiotic figures (Me). Stage X shows a mixture of spermatid steps with abnormal orientation, shape and chromatin condensation (arrows). (D) An Ehd1 -/- seminiferous tubule exhibiting a Sertoli cell only (SCO) phenotype and a (E) stage IX-XI seminiferous tubule containing step 9, 10 and 11 elongated spermatids (arrows). (F) Stage VII WT round spermatids with PAS-positive acrosomal caps on developing step 7 round spermatids (arrows). (G-H) Ehd1 -/- step 7 round spermatids display abnormal acrosomal caps (arrows), while others show abnormal displacement of the acrosomal granule, asymmetric formations and punctuate appearances. Scale bar in A = 50 μm for A-E. Scale bar in F = 10 μm for F-H.

    At day 42, the epididymides in WT mice contained mature spermatozoa whereas Ehd1 -/- mice lacked sperm (Figure 8) this defect continued into adulthood. To gain further insights into abnormal spermatogenesis, we carried out a detailed examination of 42 day old WT and Ehd1 -/- mouse testes. WT mice displayed normal spermatogenesis where a single step of round and elongated spermatids were supported by Sertoli cells in an evenly spaced and orderly fashion in seminiferous tubule cross-sections (Figure 9A-C). On the other hand, spermatogenesis only appeared normal prior to acrosome formation in Ehd1 -/- mice. Several Ehd1 -/- seminiferous tubule cross-sections exhibited a mixture of elongated spermatids (Figure 9D, steps 9-11) as well as misaligned elongated spermatids near the basement membrane, suggesting Sertoli cell phagocytosis of step 16 spermatids that failed to be released (Figure 9D-E, circles). In late stage VIII, failure of spermiation and clumping of spermatid heads was observed in addition to fusion of large aggregates of residual bodies and cytoplasmic lobes that contained clumped spermatids (Figure 9F-H, arrows). In stage X, clumping of step 16 spermatids was observed in membranous wheels and near the basement membrane (Figure 9I). Step 16 spermatids were also observed with their heads and tails fused their cytoplasm failed to form cytoplasmic lobes and residual bodies which are normally reabsorbed by Sertoli cells (Figure 9J). Ehd1 -/- testis also showed abnormal step 11 spermatids (Figure 9J). Thus, our results demonstrate clear spermatogenesis and spermiation defects in Ehd1-null testes.

    Ehd1 -/- male mice lack mature epididymal spermatozoa at day 42. Day 42 caput epididymides were Bouin's-fixed, PAS-stained and hematoxylin-counter-stained to visualize the glycoproteins (pink) and nuclei (blue) and analyzed by light microscopy using a 40× objective lens. (A) WT (+/+) epididymides contained a columnar epithelial layer (E) with a smooth actin layer (arrow) beneath the long PAS-positive microvilli that extend into the lumen. Mature spermatozoa (S) were present in the lumen. (B) The Ehd1 -/- (-/-) epididymides contained a few sloughed round spermatids (Spt) and spermatocytes (Spc). Scale bar = 20 μm.

    Day 42 Ehd1 -/- testis display a delay in spermatid development and abnormal spermatid clumping. Day 42 testes were Bouin's-fixed, PAS-stained and hematoxylin-counter-stained to visualize the glycoproteins/acrosomes (pink) and nuclei (blue) and analyzed by light microscopy using a 40× objective lens. Stages are labeled with Roman numerals. (AC) WT (+/+) seminiferous tubules displayed evenly spaced round and elongated spermatids. (D) Ehd1 -/- (-/-) seminiferous tubules contained step 9, 10, and 11 elongated spermatids (arrows) and misoriented step 16 elongated spermatids near the basement membrane (circles) and (E) abnormal step 9 spermatids along with aggregates of step 16 spermatids (circles). (F-H) Ehd1 -/- seminiferous tubules displayed membranous wheels or residual bodies (arrows, Rb) containing clumped spermatids near the lumen in stage VIII, (I) misaligned spermatids (circle) and clumped step 16 spermatid nuclei (arrows) in stage X, (J) abnormal step 11 spermatids in stage XI and step 16 spermatids clumping in membranous wheels in stage VIII. Scale bar = 50 μm.

    To further characterize the defects in spermatogenesis in Ehd1 -/- mice at the ultrastructural level, transmission electron microscopy analyses were carried out on thin sections of the testis. In stage VIII of WT testis (Figure 10A), elongated spermatids were found near the lumen or in the lumen after spermiation (Figure 10B). Elongated spermatids that had not spermiated maintained an apical ectoplasmic specialization in contact with WT Sertoli cells (Figure 10C). However, in late stage VIII of Ehd1 -/- testis (Figure 10D), elongated spermatids appeared in phagocytic, membranous wheels (Figure 10E, box). Upon closer examination, the phagocytic wheel was encased by ectoplasmic specializations and contained the nuclei, acrosomes and tails of elongated spermatids (Figure 10F). Since proper function of the Sertoli cells requires constant endocytic trafficking [31], we surmise that EHD1-dependent endocytic recycling and trafficking may be required for spermiation in mice.

    Electron micrographs of day 45 seminiferous tubules reveal abnormal phagocytic membranous wheels in Ehd1 -/- mice. (A) In WT mice, step 8 round spermatids were found in (B) early stage VIII seminiferous tubules that contained elongated spermatids in the process of spermiation near the lumen with tails apparent after spermiation box enlarged in (C). (C) A WT elongated spermatid prior to spermiation maintains its ectoplasmic specializations (ES). (D) In Ehd1 -/- mice, step 8 round spermatids were found in (E) late stage VIII seminiferous tubules that contained phagocytic membranous wheels engulfing elongated spermatids, their acrosomes and sperm tails box enlarged in (F).


    • Abstract
    • 1.1 Prokaryote Cell Membranes
    • 1.2 Eukaryote Cell Membranes
    • 1.3 Plasma Membranes
    • 1.4 Intracellular Membranes
    • 1.5 Viral Membranes
    • 1.6 Membrane Motifs
    • 1.7 The Hydrophobic Effect
    • 1.8 Structure of Water
    • 1.9 Nonpolar Molecules and Water
    • 1.10 Highlights
    • References

    Chapter 2. The Lipids of Biological Membranes

    • Abstract
    • 2.1 Phospholipids
    • 2.2 Sphingolipids
    • 2.3 Glycolipids
    • 2.4 Sterols
    • 2.5 Two-Headed Lipids
    • 2.6 Lipopolysaccharide
    • 2.7 Lipid Identification
    • 2.8 Highlights
    • References

    Chapter 3. Biogenesis of Membrane Lipids

    • Abstract
    • 3.1 Desaturation of Fatty Acids
    • 3.2 Biosynthesis of Phospholipids
    • 3.3 Biosynthesis of Sphingolipids
    • 3.4 Cholesterol Biosynthesis
    • 3.5 Assembly of Newly Synthesized Lipids into Membranes
    • 3.6 Highlights
    • References
    • Abstract
    • 4.1 Nonionic Detergents
    • 4.2 Ionic Detergents
    • 4.3 Detergent Properties
    • 4.4 Detergents and Membrane Rafts
    • References

    Chapter 5. Membrane Models

    • Abstract
    • 5.1 The Evidence for the Lipid Bilayer
    • 5.2 The Singer Nicholson Model for Membranes
    • 5.3 Current Model for Biological Membranes
    • 5.4 Highlights
    • References

    Chapter 6. Laboratory Membrane Systems

    • Abstract
    • 6.1 Structure of Laboratory Membrane Systems
    • 6.2 Properties Derived from Laboratory Membrane Systems
    • 6.3 Hydration
    • 6.4 Ion Binding
    • 6.5 Highlights
    • References

    Chapter 7. Structures of Lipid Assemblies

    • Abstract
    • 7.1 Lamellar (Bilayer) Structure
    • 7.2 Interdigitated Bilayers
    • 7.3 Micellar Phase
    • 7.4 Hexagonal I Phase (HI)
    • 7.5 Hexagonal II Phase (HII)
    • 7.6 Cubic Phase
    • 7.7 Subphase for Phospholipid Bilayers
    • 7.8 Solution Phase
    • 7.9 Lipid Phase Transitions
    • 7.10 Phase Transitions in Cell Membranes
    • 7.11 Lamellar to HII Phase Transition
    • 7.12 Lipid Microdomains in Membranes
    • 7.13 Lipid Conformation in Membranes
    • 7.14 Water in the Lipid Bilayer
    • 7.15 Highlights
    • References

    Chapter 8. Lipid Dynamics in Membranes

    • Abstract
    • 8.1 Introduction
    • 8.2 ESR
    • 8.3 2H NMR
    • 8.4 Motional Order
    • 8.5 Motional Rates
    • 8.6 Integrated View of Motional Order and Dynamics
    • 8.7 Membrane Fluidity
    • 8.8 Free Volume within a Membrane Bilayer
    • 8.9 Lateral Diffusion of Membrane Components
    • 8.10 Lateral Phase Separation
    • 8.11 Transmembrane Movement of Lipids
    • 8.12 Movement of Phospholipids Between Membranes
    • 8.13 Transmembrane Lipid Asymmetry
    • 8.14 Highlights
    • References

    Chapter 9. Cholesterol and Related Sterols: Roles in Membrane Structure and Function


    4 DISCUSSION

    We demonstrated that miRNAs regulated the AQP5 expression in the highly aggressive and invasive triple-negative breast cancer cell line (MDA-MB-231 cells). AQP5-targeting miRNAs were identified using bioinformatic analyses based on the sequences of the AQP5 3ʹ-UTR and miRNAs (Table 1). When MDA-MB-231 cells were overexpressed with the identified AQP5-targeting miRNA (miR-1226-3p, miR-19a-3p, or miR-19b-3p), AQP5 protein expression was significantly decreased, associated with the inhibition of cell migration in response to the chemotactic and LDL-stimulated conditions. To deliver AQP5-targeting miRNAs to cancer cells efficiently, exosome-mediated delivery of miRNAs was established. Tumor targeting peptide (IL-4RPep-1) and AQP5-targeting miRNA (miR-19b-3p) were co-expressed in exosomes, which were secreted from HEK293T cells into the conditioned medium. Then, the conditioned medium successfully delivered miR-19b-3p to MDA-MB-231 cells and significantly decreased AQP5 protein expression and cancer cell migration.

    The transient transfection of miRNAs into MDA-MB-231 cells remarkably increased the relative level of miRNA (Figure 2A). After the administration of the respective miRNA mimic into MDA-MB-231 cells, the relative expression level of miR-1226-3p to that of negative control siRNA-treatment became very high (928-fold), which was in contrast to the changes in the expression levels of miR-19a-3p (53-fold) and miR-19b-3p (201-fold). Differences in cellular levels between miRNA mimics after the transfection of the same amount of each miRNA mimic might be due to the difference in the endogenous expression level of each miRNA, since relative fold changes were estimated by comparison to the endogenous miRNA level. Indeed, a previous high-throughput miRNA profiling based on the RNA-seq analysis (GSE108286) demonstrated that the endogenous expression level of miR-1226-3p (read count: 35) was much lower than that of miR-19a-3p (read count: 2832) and miR-19b-3p (read count: 5055) in MDA-MB-231 cells. However, despite the vast increase in miRNA levels after the transfection of the respective miRNA mimic, it should be noted that only a limited amount of miRNA mimic could play a role in the regulation of target genes. Consistently, recent studies revealed that the increment in miRNA expression after transient transfection of miRNA mimic did not represent the level of authentically active miRNA, since the population of miRNA that could interact with RISC complex was limited. 52 Figure 2B showed that AQP5 mRNA expression was markedly decreased by miR-1226-3p mimic transfection. The results indicated that miR-1226-3p is likely to be involved in the degradation of AQP5 mRNA that led to a decrease in the protein expression of AQP5. Another possibility is that miR-1226-3p possibly targets the 3ʹ-UTR of AQP5-regulating genes which inhibit the transcription of AQP5. However, the putative targets of miR-1226-3p, which might regulate AQP5 transcription need to be explored.

    miR-1226-3p is located in the 3p21.31 (chromosome 3:47,849,555-47,849,629) and the sequence of miR-1226-3p is UCACCAGCCCUGUGUUCCCUAG. miR-19a-3p and miR-19b-3p are located in the 13q31.3 (chromosome 13:91,350,891-91,350,972 and 91,351,192-91,351,278, respectively) and have the sequences UGUGCAAAUCUAUGCAAAACUGA and UGUGCAAAUCCAUGCAAAACUGA, respectively, which show a difference of only one nucleotide (eleventh nucleotide: U or C). miR-19a-3p and miR-19b-3p retain the same seed sequences and share common target genes (nine common target genes in the gap junction pathway, microT > 0.8 and P < .05, Table 2). In the present study, three target sequences of miR-1226-3p, which were predicted by DIANA-tools, did not respond to the miR-1226-3p mimic in MDA-MB-231 cells, whereas AQP5 protein expression was significantly decreased. Thus, it could be speculated that there may be other target sequences in the 3ʹ-UTR of AQP5 mRNA which are responsive to miR-1226-3p. miR-19a-3p and miR-19b-3p have common seed sequences. However, miR-19b-3p significantly reduced the luciferase activity in MDA-MB-231 cells expressing the target sequence 2 (Figure 2C,D), whereas miR-19a-3p did not. This finding suggested that miR-19b-3p might directly interact with the 3ʹ-UTR of AQP5 mRNA and regulate AQP5 expression by disrupting the translational process of AQP5 mRNA. According to the analysis of DIANA-tools, a nucleotide in the miR-19b-3p (cytosine, C in the eleventh nucleotide) is more complementary than a nucleotide in the miR-19a-3p (uracil, U in the eleventh nucleotide), thereby, miR-19b-3p is possibly more reactive to the target sequence 2. Although miR-19a-3p mimic transfection did not show a decrease in the luciferase activity, the observed significant decrease in AQP5 protein expression could suggest that miR-19a-3p might also interact with other unexplored target sequences in the 3ʹ-UTR of AQP5 mRNA. Moreover, it is possible that miR-19a-3p targets other genes that can regulate the translation of AQP5.

    Previous evidence showed that miR-1226, miR-19a, and miR-19b are involved in the regulation of cancer-related proteins. It was reported that miR-1226 plays a role as a tumor suppressor via the downregulation of mucin 1 expression in breast cancer cells (MCF-7 and MCF-10A) by interaction with the 3ʹ-UTR of mucin 1. 53 miR-19a-3p was reported to target the FOSL1 gene coding for transcription factor Fos-related antigen 1 (FRA-1) in tumor-associated macrophage that enhanced the migration and invasion of breast cancer cells. 54 Also, miR-19a-3p directly interacted with the 3ʹ-UTR of tissue factor (the primary initiator of coagulation) and reduced the migration and invasion of colon cancer cells (LoVo and DLD1). 54 In the tissues obtained from gastric cancer patients, expression of miR-19b was significantly decreased compared with tumor-adjacent tissues. 55 The overall survival rate and disease-free survival rate were significantly lower in gastric cancer patients with lower expression of miR-19b. 55 Moreover, stably overexpressed miR-19b-1 in MDA-MB-231 cells gave rise to tumor growth arrest in the mouse model via the regulation of angiogenic activity. 56

    Consistent with the aforementioned studies, we demonstrated that the transfection of mimics of miR-1226-3p, miR-19a-3p, and miR-19b-3p markedly attenuated the migration of MDA-MB-231 cells in response to the chemotactic conditions (Figure 3A,B). LDL stimulation has been shown to induce cell proliferation and migration of MDA-MB-231 cells, 39 and we have also previously demonstrated that LDL stimulated migration of MDA-MB-231 cells. 44 In this study, while LDL treatment (50 μg/mL, 24 hours) expedited MDA-MB-231 cell migration, it was significantly impeded by miR-1226-3p, miR-19a-3p, and miR-19b-3p mimic transfection (40 nM, 48 hours, Figure 3C,D). Transwell cell migration assay showed that cell migration of MDA-MB-231 cells transiently transfected with miR-19b-3p alone was more impeded (Figure 3B), compared to the approach using IL-4RPep-1 and miR-19b-3p (Figure 6D). This finding could be explained by the different expression levels of miR-19b-3p (Figure 2A vs Figure 6A), and accordingly, AQP5 expression levels were different (Figure 1D vs Figure 6B). Moreover, in terms of the dose of miRNA, we used a higher dose of miRNA (80 nM) instead of a lower dose (40 nM) in the experiments to study whether culture medium that contains exosomes expressing IL-4RPep-1 and miR-19b-3p could affect cell migration with the following reasons. When miR-19b-3p (40 nM) was directly transfected to MDA-MB-231 cells, the expression level of miR-19b-3p was increased by

    200-fold in the cells (Figure 2A). In contrast, as shown in Figure 5D, the loading of miRNA (40 nM) into IL-4RPep-1-expressing exosomes in HEK293T cells resulted in the significant increase of miR-19b-3p in the exosomes, but it was only an 8.8-fold increase compared with control HEK293T cells or 12.3-fold increase compared with IL-4RPep-1 vector-transfected HEK293T cells. Moreover, as shown in Figure 6A, MDA-MB-231 cells treated with conditioned medium collected from HEK293T cells co-transfected with both pDisplay-IL-4RPep-1 vector and miR-19b-3p mimic (40 nM) showed an increased level of miR-19b-3p, but it was a 4.1-fold increase. Thus, for the cell migration assay in Figure 6D, we increased the dose of miR-19b-3p to 80 nM for transfection to HEK293T cells rather than 40 nM in order to deliver more miR-19b-3p to migrating cells via exosomes-containing culture medium.

    We previously showed that the shRNA-mediated AQP5 knockdown attenuated cell migration of MCF-7 cells in vitro and higher AQP5 expression in breast cancer tissues of patients was associated with lymph node metastasis in vivo. 13 In addition to the direct effect of AQP5 on breast cancer cell migration, we also demonstrated that activated Rac1 was increased in breast cancer patient tissues. 16 Rac1, a GTPase importantly involved in cancer cell migration, is likely to be a downstream target of AQP5 in breast cancer. 16 DIANA-mirPath predicted that miR-1226-3p, miR-19a-3p, and miR-19b-3p have target genes in the gap junction pathway (Table 2) and qRT-PCR and semiquantitative immunoblotting were performed to examine the effect of miRNAs on these target genes. As shown in Table 3, mRNA expression of NRAS and ITPR1 gene was significantly decreased after miR-1226-3p or miR-19b-3p transfection in MDA-MB-231 cells, respectively. Interestingly, protein abundance of connexin-43, the product of the GJA1 gene, was significantly decreased after miR-19a-3p or miR-19b-3p transfection. The participation of these identified miRNAs in the gap junction pathway has not been explored and interactions of these identified miRNAs and the target genes in the gap junction pathway need to be studied in breast cancer cell migration and metastasis.

    We demonstrated that AQP5 protein abundance in MDA-MB-231 cells was more decreased in response to transfection of miR-19a-3p or miR-19b-3p, compared with that of miR-1226-3p (Figure 1B vs Figure 1D). miR-19a-3p and miR-19b-3p did not change the abundance of AQP5 transcripts (Figure 2B), indicating that miR-19a-3p and miR-19b-3p are likely to regulate the abundance of AQP5 protein at the translational level. Furthermore, luciferase reporter gene assay demonstrated that miR-19b-3p directly interacts with the 3ʹ-UTR of AQP5 mRNA and leads to the inhibition of translation (Figure 2D). Considering the distinct effect of miR-19b-3p in the regulation of AQP5 abundance, miR-19b-3p was selected and applied to the studies of exosomal delivery to breast cancer cell line. In MDA-MB-231 cells, treatment with a conditioned medium containing IL-4RPep-1/miR-19b-3p mimic expressing exosomes resulted in a significant increase in cellular miR-19b-3p (

    4.1-fold, Figure 6A) and a decrease in AQP5 protein expression by

    30% compared to the control group (Figure 6C). Interleukin-4 receptor (IL-4R) is widely known to be expressed in several cancer cells, including renal cell carcinoma, breast cancer, pancreatic cancer, and malignant pleural mesothelioma (MPM). 57-60 The expression of IL-4R is overexpressed in the malignant pancreatic cancer and MPM, and the increased expression of IL-4Rα, a major subunit of IL-4R, was associated with poor survival in patients, indicating that overexpression of IL-4R is related to the malignancy of cancer cells. 57, 60 Thus, IL-4R-mediated therapeutic attempts have been tried widely. 36, 40 For example, a previous study demonstrated that IL-4R-targeted siRNA complexes specifically interacted with IL-4R and were efficiently internalized. 36

    In the present study, we demonstrated that the IL-4R-binding peptide (IL-4RPep-1)-expressing exosomes delivered miRNA more efficiently, compared with exosomes expressing miRNA alone (Figure 6E). We have engineered exosomes and isolated exosomes to examine the expression of miR-19b-3p expression in the exosome (Figure 5). However, for the delivery of miRNA to MDA-MB-231 cells we did not use the isolated exosomes but used the exosome-containing conditioned medium collected from IL-4RPep-1/miR-19b-3p mimic-co-transfected HEK293T cells. This was mainly due to the technical limitation in the massive production and purification of IL-4RPep-1 expressing exosomes containing miRNAs, that is, bioengineered exosomes. It has been acknowledged that the availability of sufficient quantities of exosomes for animal studies or clinical trials is one of the limitations of exosomes as therapeutic agents. 61 Other limitations are the lacking of methods for the isolation of homogeneous populations of exosomes and cost-ineffectiveness. 61, 62 Future studies are needed to make genome-engineered cell lines, which produce both IL-4RPep-1 and miRNAs stably. However, as shown in Figure 6A, qRT-PCR revealed that miR-19b-3p was successfully delivered to MDA-MB-231 cells when cells were treated with conditioned medium collected from IL-4RPep-1/miR-19b-3p mimic-co-transfected HEK293T cells. Moreover, as shown in Figure 6B, AQP5 protein expression was significantly decreased when MDA-MB-231 cells were treated with conditioned medium collected from IL-4RPep-1/miR-19b-3p mimic-co-transfected HEK293T cells for 48 hours. Therefore, these data indicated that conditioned medium collected from IL-4RPep-1/miR-19b-3p mimic-co-transfected HEK293T cells contained exosomes expressing miR-19b-3p, which delivered miR-19b-3p and decreased AQP5 protein expression in MDA-MB-231 cells.

    The isolated exosomes from non-transfected HEK293T cells and HEK293T cells transfected with IL-4RPep-1-expressing pDisplay vector showed the expression of TSG101 and CD63 and they were mostly <200 nM in size (Figure 5C). Importantly, the size distribution of extracellular vesicles in the conditioned medium collected from HEK293T cells [non-transfected, IL-4RPep-1 transfected or IL-4RPep-1/miR-19b-3p mimic-co-transfected] was mostly <200 nm, which was not different from the isolated exosomes (Figure 5E). However, in contrast to the isolated exosomes, they also showed minor fractions that had ranges >200 nm in size, suggesting that there might be other extracellular vesicles or factors in the culture medium potentially affecting the changes in AQP5 expression and this needs to be explored in future studies.

    Interestingly, when cancer cells were treated with an exosome-containing medium for a shorter period, IL-4RPep-1 expressing exosome could deliver miRNAs more efficiently to the recipient cells through receptor-mediated endocytosis. In contrast, with longer duration of treatment, exosome delivery of miRNA was not likely to be dependent on the expression of the tumor-targeting peptide on the surface of exosomes. Thus, we speculated that the effect of receptor-mediated endocytosis could be overridden by other mechanisms, including fusion, micropinocytosis, or phagocytosis, which are known for the ways for uptaking exosomes. 63 At the current stage, an application of IL-4RPep-1-expressing exosomes loaded with miRNAs to animal disease models has a limitation due to the difficulties of massive production and purification of IL-4RPep-1 expressing exosomes containing miRNAs, which needs to be further explored.

    In summary, we identified novel AQP5-targeting miRNAs and examined their role in the regulation of AQP5 expression and migration of breast cancer cells. The effects of AQP5-targeting miRNAs were revealed in human breast cancer cells by delivering the bioengineered exosomes co-expressing AQP5-targeting miRNAs and a peptide (CRKRLDRNC: IL-4RPep-1) targeting the IL-4R, which is abundantly expressed in breast cancer cells.


    Watch the video: Receptor Mediated Transport (August 2022).